Source I suggests that attitudes to Elvis Presley Essay Example for Free

Source I suggests that attitudes to Elvis Presley Essay Q. 5. Source I suggests that attitudes to Elvis Presley were beginning to change by 1958. Use the source, and you own knowledge, to explain why this was happening. By 1958 Elvis Presleys popularity and acceptability with adults was still unchanged, and his manager, Colonel Parker, decided to revamp Elvis image to better suit the tastes of the older generations. In order to achieve this Elvis was persuaded to do what every other young American man was obliged to do at the time: spend time assigned to the US Army for National Service, wearing fatigues and earning a pittance. This gained him good publicity as can be seen from Source I, which is obviously keen on Elvis as it is using him to demonstrate the brilliance of Americas society and American democracy. The article is making use of his rise to fame (how he was a nobody who became a somebody so quickly) to prove how the American dream (how anybody can be famous and dreams can come true in America) is really possible. The article also states how Elvis did not simply use his riches and influence to buy his way out of this duty to his country. By serving his time in the Army alongside other, ordinary draftees and not asking for special favours, and because of the good publicity he got from it, Elvis gained great respect from the older, patriotic generation, making them feel less negative towards him. It would have seemed now to parents that Elvis was setting a good, nationalistic example to their children, showing them the right path, and they liked him and the impact he was having better for this reason. He was also seen as not rebelling against what society expected of him, again making him more acceptable by the old as a role model for the young. The source differs from sources B and C in that it is not being critical of Elvis, and it is showing how he might have a good influence rather than a wholly bad one. The opinions have changed so much at this point and continued to change after Elvis returned from the Army mainly because Elvis was no longer as shocking, and therefore not as dangerous an influence on the young, or the morality of American society through outrageous television performances (after the third Sullivan appearance, Elvis manager raised his television price from $50000 to $300000, and the networks refused the new proposal, so Elvis didnt do TV again until 1960). For example, Elvis shocking ducktail haircut was shorn, and Pageant magazine reported: Fans cried, parents sighed. On becoming a G. I. in the Army, Elvis said: Its a duty Ive got to fill, and Im gonna do it. I guess the only thing Ill hate about it is leaving my mama. Shes always been my best girl. This showed that Elvis had family values, and love for his mother, which would have made him seen more normal and down-to-earth (or less shocking and less rebellious). Again Elvis would have made parents think he would lead their children the right way, rather then corrupting their morals. By the time Elvis had returned from the Army in 1960, his TV appearances would have lost their initial shock. He was still popular, but the primal hysteria was gone, and shortly the fan magazines for teenagers would have had the Beatles to talk about. After joining the Army, Elvis also changed his musical style, performing some religious songs and doing a duet with Frank Sinatra, the grown-ups music star, making him a lot more acceptable, even likeable. It was around this time that Elvis started to star in his own films, but these films werent action packed or shocking. They were mainly romances and love stories, portraying the softer, tenderer side of Elvis that seemed less threatening to the adult generation. Generally, adults attitudes towards Elvis were beginning to improve by 1958 because of the change in his image. The youth however maintained their rebelliousness, and Elvis popularity among teenagers dropped slightly as they saw that adults found him more acceptable, or lost interest because he was no longer as downright shocking or rebellious as before.

Characterisation of Prostate Cancer Stem Cells

Characterisation of Prostate Cancer Stem Cells Abstract Background Advances in the study of cancer cells with stem cell characteristics may enable the development of new and improved cancer therapies. Stem cell marker expression can be investigated by QPCR and this sensitive method has been used to characterise prostate cancer stem cells. Methods Prostate cancer cell lines LNCaP and C42B were grown under adherent and nonadherent culture conditions. Non-adherent culture generated prostaspheres that are enriched in stem cells. In addition, LNCaP and C42B prostaspheres were treated with Wnt3a. RNA was extracted from both adherent and prostasphere cultures of LNCaP and C42B cells. cDNA was synthesized and QPCR analysis was performed with TaqMan probes in order to examine the expression of 10 genes: Nestin, Oct4, Sca-1, BMI-1, PSA, NSE,CD44, K18, ABCG2 and c-kit. Results Prostasphere culture caused a dramatic increase in the relative expression of ABCG2 and Keratin 18 in both cell types. Conclusion The findings suggest ABCG2 may be a valuable marker for identification of prostate cancer cells with stem cell characteristics. Moreover this technique of Q-PCR may prove to be a sensitive method of evaluating markers in cancer patients. Introduction Prostate cancer is commonly diagnosed in males over 60 and is the second most common cause of cancer death in UK in men, after lung cancer (1). Following diagnosis, prostate cancer is categorised in low risk, intermediate risk and high risk. For low risk cases treatment is usually under active surveillance while intermediate and high risk is treated by surgery and radiation. Advanced cases (presence of metastasis) treatment is by androgen ablation and it almost always produces objective clinical responses (2). However, in most patients there is relapse with the development of androgen independent prostate cancer, which is associated with a median survival, of 20–24 months (3). Currently, androgen independent metastatic prostate cancer is treated by Docetaxel an anti-mitotic that extends life by an average of 3 months (3). Although, the mechanisms of prostate cancer development and progression have been extensively studied this process is not fully understood. Several genes including MYC and PTEN have been linked to the development of prostate cancer (28). However, one of the most important discoveries in the genetics of prostate cancer is the identification of TMPRSS2-ETS fusion protein that arises as a result of a genetic translocation (4). TMPRSS2 is androgen-regulated transmembrane serine proteases secreted by normal prostatic tissue and an increase in androgen level increases TMPRSS2 expression. ETS family transcription factor (ERG, ETV1, or ETV4) targets genes involved in cell transformation, growth and apoptosis. Therefore fusion of TMPRSS2 gene promoter with one of the member of ETS family results in positive dysregulation of the ETS gene. TMPRSS2-ETS fusion proteins have been speculated to play a role in the development of up to 50% of prostate cancers but not the progression to androgen independence (4). Androgen independent prostate cancer has been postulated to arise as a consequence of increase activity of the androgen receptor (AR), altered cell signalling pathways, or the survival and proliferation of prostate cancer stem cells. Recent papers have conceptualized that cancer can arise from cancer cells with the characteristics of stem cells, unlimited self-renewal and the ability to produce differentiated daughter cells (5). These cells have been termed cancer stem cells (10) and may promote tumour growth, metastasis and relapses, thus having a huge impact on patient survival. The cancer stem cell model hypothesis is that cells with stem cell characteristics accumulate genetic changes over long period of time, escape the environmental control and give rise to cancerous growth. There is good evidence that cancer stem cells cause leukaemias and it has also reported that cancer stem cells can contribute to solid tumour development in brain, breast, colon and prostate. As prostate cancer is a heterogenic disease, several distinct cancer stem cell populations maybe present in a tumour (5). On basis of this knowledge, the role of cancer stem cell is been explored in solid tumours. For instance in prostate cancer mutation of the androgen receptor may result in the growth of tumour that can sustain androgen deprivation or very low level of androgen or use alternative pathways involving growth factors and cytokines. Recent studies (6) have also identified mammary stem cells as being a potential source of breast cancer, tumour relapse and tumour metastasis. For this reason it is vital to understand the stages of cell differentiation in normal prostate epithelium and identification of cells that are involved in prostate carcinogenesis and androgen independent prostate cancer. The prostate is a glandular organ comprising of three distinct epithelial cell populations that may contribute to tumorigenesis (7). Each prostatic duct is lined by nonsecretory basal cells which form a layer along the basement membrane (figure 1). Luminal cells are the major secretory cell, producing 30% of seminal fluid components and lining the lumen of duct and acini. These luminal cells are highly differentiated and expresses prostate specific antigen, cytokeratin 8 and 18 and the nuclear androgen receptor (27). Neuroendocrine cells are also present along the basement membrane and secrete neuroendocrine peptides that support epithelial growth and viability. Vascular components and stromal endothelial cells are also present in the gland. Figure 1. Schematic presentation of the cell types within a human prostatic duct. (Adapted from Abate-Shen, C. Shen, M et al 2000) Recent evidence has suggested stem cells are also present within the prostate cancer cell population. It have been theorized that stem cells may lie in the basal layer of prostate in man and in the basal and luminal compartments in mice (19). A transient amplifying population of daughter cells arises from these stem cells and generates differentiated PSA producing cells in man. Stem cells can have different characteristics, including resistance to apoptosis and increased expression of multidrug resistant transporters (8, 23, 24, 25 ). The findings of Collins et al 2001 (9) revealed that stem cells can be distinguished from the transient amplifying cells and showed there is 2-3 fold increases in expression of surface level of integrin ÃŽ ±2ÃŽ ²1. Figure 2. Hypothetical model of stem cells showing normal prostate development and prostate cancer (De Marzo MA et al 1998). De Marzo MA et al 1998 in his paper states pluripotent stem cells are capable of differentiation and self-renewal and is present in the basal epithelium of the prostate, which contains cytokeratin 5 and 14 expressing cells (figure 2). Intermediate progenitor populations located within the basal epithelium expresses both basal and secretory cell characteristics (11). Intermediate cells with limited proliferative capacity can differentiate into mature secretory luminal (androgen receptor positive) or neuroendocrine cells which are non-proliferative. In prostate cancer, it is proposed that transformation occurs which leads to the proliferation of cells with stem cell characteristics and the production of an excess of cells with luminal characteristics (Bisson and Prowse 2009). Normal murine prostate stem cells have been functionally identified by their ability to form prostate spheres (13) and to form differentiated prostate tubular structures when returned to an in vivo environment (13, 14). The in vivo generation of prostate structures from normal human prostate cells in xenograft studies and the ability to isolate a human basal prostate cell population with enriched capacity for prolonged clonal expansion and luminal differentiation have led to the hypothesis that normal human prostate stem cells are located within the basal layer of the gland (15-18). English HF et al 1987 (19) in an experiment found following androgen ablation of rodent prostate glands the stem cells exhibited regenerative properties especially of the secretory cells indicating these cells are self- sustainable, which supports the hypothesis that stem cells reside within the basal layer of the gland and are able to survive in absence of androgen environment. These cells may also therefore have the ability to survive androgen deprivation therapy and contribute to the development of metastatic prostate cancer. At present proper characterization of stem cells has been limited by the absence of specific markers that distinguishes stem cells from their more differentiated progeny. Gene expression and microarray profiling may be able to identify specific markers. These markers may also be prognostic for patient response to therapy and survival. Past papers have discussed non-adherent culture media techniques to isolate neuronal, colon and breast cancer cells that exhibited stem cell characteristics. In a recent paper by Bisson and Prowse et al 2009 (10) the authors studied prostate cancer cell lines (22RV1, DU145, PC3, VCaP, LNCaP and the LNCaP subline C4-2B) and were able to form prostosphere in non adherent culture conditions. Prostosphere were able to form from both AR positive (LNCaP, VCaP, 22RV1) and AR negative (PC-3, DU145) cell lines. Analysis of marker protein expression of proliferation (ki67) and differentiation (keratin 18 and PSA) of prostosphere revealed that cell heterogenecity existed within the prostaspheres, which may be due to different percentages of stem cells within the cell lines or maybe related to adaptation to their environment in the nonadherent culture conditions. Immunoflourescence (Figure 4) of these prostospheres with stem cells associated markers (CD44, CD133, ABCG2) showed increase in expression compared with the adherent cultures, consistent with enrichment for stem cells. However this analysis was only performed by immunofluorescence, and was limited by the semi-quantifiable nature of this technique and the antibodies available (10). Aim Quantitative analysis of cells with stem like characteristics in prostate cancer has not been attempted yet. The aim of my project is therefore, quantitative PCR (QPCR) analysis of stem cells associated gene expression of the prostosphere compared to that of the adherent culture. Material and Methods For my project I used the prostate cancer cell lines DU145, LNCaP and the LNCaP subline C4-2B. The prostasphere formation (P0) is highest in the cell types of LNCaP and its androgen independent derivative C42B, which both express AR and PSA (23). I conducted my experiments by real time PCR to measure the mRNA level of expression on cDNA extracted from prostasphere of LNCaP and subline of LNCaP, C42B cell line. This assay is both qualitative and quantitative and allowed me to compare the RNA gene expression in relation to the control (GAPDH). However there are certain limitations of using this method in my experiment. The prostasphere is heterogenic and the stem cell population within probably only a small fraction of the cells. Therefore it will be interesting to see how this affects the gene expression of the mRNAs. Cell Culture Prostate cancer cell lines LNCaP, C42B and DU145 were cultured at 37 °C in RPMI using 10% fetal bovine serum (Invitrogen), 2.4 mM glutamine (Sigma-Aldrich), 1% (v/v) pyruvate (Sigma-Aldrich), penicillin and streptomycin (50 U and 50 ÃŽ ¼g/ml) (Invitrogen). Trypsin (Sigma-Aldrich) was used to detach adherent cells, prior to cell counting, passage or analysis (10). Prostasphere cultures were established on low attachment 6-well plate (Costar) when single cells were plated in DMEM/F12 (Invitrogen) supplemented with B27 and N2 (Invitrogen) and grown under these conditions for 6-12 days (Bisson and Prowse 2009). These proliferating spheres of cells are enriched for stem cells (Bisson and Prowse 2009) and were prepared for these experiments by Dr Prowse. The prostasphere medium was also supplemented with WNT3a at 20 µg/ml (RD Systems) and the Hedgehog pathway inhibitor cyclopamine for 6 days prior to analysis. RNA Extraction RNA was extracted from prostate cancer cell lines LNCaP, C42B and DU145 cells (stored at -70 °C and thawed at 37 °c before extraction) using RNeasy Kit (Superscript II enzyme and Poly-A primer) from Qiagen. 600 µl of RLT Plus (10 µl of ÃŽ ²-mercaptoethanol was added to 1ml of RLT Plus buffer prior to the experiment) was added to the cells. The lysate was then added to the QIAshredder spin column sitting on a 2ml eppendorf and centrifuged for 2 minutes at maximum speed (14000 x g). The flow through was transferred to another tube and an equal volume of 70% ethanol was added and mixed by pipetting several times. 700 µl of the samples was added to a RNeasy spin column and centrifuged for 15 secs for 14000 x g. The flow through was discarded and 700  µl of buffer RW1 (supplied) was added to the spin columns and centrifuged for 15 secs at 14000 x g. The flow through was discarded and the column was placed on a new collection tube. 500  µl of buffer RPE was added to the column and centrifuged for 2 minutes to dry the RNeasy membrane. To further dry the membrane the column was placed on another tube and centrifuged at maximum speed for one minute to completely dry the column and to remove the trace of RPE buffer. The column was then transferred to another collection tube and 30  µl of RNAse free water was added. Finally the tube was centrifuged for one minute (14000 x g) and the elute collected. The RNA was stored at -80 °C freezer (detailed protocol attached in Appendix). Reverse transcription c-DNA synthesis was done by using SuperscriptTM III First-Strand Synthesis System for RT-PCR. According to the manufacturer’s instruction 2  µl (2  µg) of previously prepared RNA was added to 1 µl of 50uM oligo (dT)20, 1 µl of 10mM dNTP mix in a tube and DEPC-treated water added to make a volume of 10  µl. The reaction tube was incubated at 65 °C for 5 mins and then placed on ice for one min. In another tube 2  µl of 10X RT buffer, 4 µl of 25mM Mgcl2, 2  µl of 0.1DTT, 1  µl of RNaseOUTTM (40U/  µl) and 1  µl of SuperScriptTM III RT (200 U/  µl) was added. The 10  µl mix of the first tube was added to the second tube and incubated for 50 mins at 50 °C. The reaction was terminated by incubating at 85 °C for 5mins and then chilled on ice. 1  µl of RNase H was added to the tube and incubated for 20 mins at 37 °C. The total yield of cDNA was 25  µl and this was stored at -20 °C till further use. Polymerase Chain reaction Polymerase chain reaction was carried out on the cDNA synthesized, using GREX-f* primer GAGTACCTCTGGAGGACAGA and GRINTRON-r* primer ATGCCATTCTTAAGAAACAGGA. For each reaction 5  µl of 10xPCR buffer II, 3 or 6  µl of 25mM MgCl2, 4  µl of 10mM dNTP, 1  µl of forward and reverse primer at 10  µM and 0.25  µl of AmpliTaq Gold Enzyme were mixed in a tube. cDNA at 10 ng/ µl was added to the reaction tube and made upto 50 ul with deionised water. The reaction was run at 94 °C for 6 min, and then 35 cycles of 94 °C for 30 secs, 55 °C for 30 secs, 68 °C for 30 secs, 72 °C for 30 secs followed by 72 °C for 6 mins. Gel Electrophoresis In order to see the purity of the cDNA synthesized (not contaminated with genomic DNA) gel electrophoresis was carried out. 2% Agarose Gel was prepared with TBE and cyber red added as a fluorescent tag. The gel was poured on a gel plate and a comb was inserted and ran for 30mins at 90V. Relative Quantitative PCR In real-time quantification technology the TaqMan MGB probes contain: †¢ A reporter dye (6-FAM) linked to the 5 ´ end of the probe. †¢ A minor groove binder (MGB) that increases the melting temperature (Tm) without increasing probe length (Afonina et al., 1997; Kutyavin et al., 1997); it also allow the design of shorter probes. A nonfluorescent quencher (NFQ) at the 3 ´ end of the probe 5 ´ Nuclease Assay Process A TaqMan probe contains a reporter dye at the 5 ´ end and a quencher dye at the 3 ´ end of the probe. The DNA polymerase cleaves the TaqMan probe during PCR and separates the reporter dye and quencher dye. This cleavage results in increased fluorescence of the reporter dye (26). Figure 3.TaqMan ® probes require a pair of PCR primers in addition to a probe with both a reporter and a quencher dye attached. When the probe is cleaved, the reporter dye is released and generates a fluorescent signal (Invitrogen). The reporter dye does not fluoresce if the probe is intact. During PCR, if the target of interest is present, the probe specifically anneals between the forward and reverse primer sites. On the other hand if the probe hybridizes to the target the DNA polymerase cleaves the probes between the reporter and quencher. The fragmented probes then separate from the target of interest and further polymerisation of the strand continues (26). For quantification of the change in expression of mRNA the ABI 7500 was used to perform the thermal cycling, data collection and data analysis. In a MicroAmp 96 well plate (Applied Biosystem) 10  µl of final volume of TaqMan mix was placed. The mixture included 5 µl of TaqMan Gene Expression Assay, 0.5  µl of the primer, 0.5  µl of GAPDH (endogenous Control) and 4  µl of 1:3 diluted samples. Prior to this study Ct value (cycle threshold) with a standard curve (Fig 5) was constructed and the primer and GAPDH concentration were determined by optimisation studies. All the primers were purchased from applied biosystem and are listed in Table 1. Using the ABI 7500 system the PCR was carried out at 50 °C for 2 min, followed by 95 °C for 10 mins. Then 40 cycles of 95 °C for 15 secs and 60 °C for 60 secs were performed. Mean relative quantification (RQ) was evaluated using the à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct method using GAPDH as endogenous control. Prior to analysis the PCR products were run on a 2% agarose gel to confirm that the templates have amplified along with GAPDH as endogenous control (figure 5). DATA Analysis The data generated from the RT-PCR were analysed using the recommended threshold by Applied Biosystem and then exported in Excel format. For calibration and generation of standard curves several cDNA cell lines were used: cDNA from DU145, LNCaP and C42B. The slope of the standard curve was calculated from the log input of cDNA in ng/ µl versus the corresponding Ct value. Basic statistical analysis was performed in Excel. Results Cell Culture Dr Prowse used a non adherent technique suspension culture and identified a group of cells within the prostate cell lines 22RV1, DU145, PC3, VCaP, LNCaP and C42B that had the ability to form prostasphere (Figure 4a). Furthermore using the clonal growth assay, each prostasphere was able to grow a further 1-3 prostaspheres (5b) when dissociated to single cells (10). These prostasphere along with prostate cell lines were used in this study. Immunoflourescence conducted by Dr Prowse on the prostate cancer spheres derived from single cells are illustrated in Figure 4A. Figure 4. Representation of prostasphere formation, culture and the effect of Wnt3a on Keratin 18, CD44 and ABCG2. A) Prostasphere shows self renewal and proliferation and this is a schematic representation of this process. B) Prostasphere formation with 0.1% DU145, 8% LNCaP and 8% of C42B cell lines. C) Effect of Wnt3a on keratin 18, CD44 and ABCG2 (Bisson and Prowse et al 2009). RNA extraction and RT—PCR Upon RNA extraction of the cells lines and prostospheres the concentrations were measured by spectrophotometer. It was 234ng/ µl for C42B and 190ng/ µl for DU145 respectively. A PCR was conducted with glucocorticoid receptor gene intron primers and gel electrophoresis was carried out to verify the purity of the samples. Only genomic cDNA of LNCaP and Hela cells amplified under 3 mMMg++ conditions (Figure 5). Figure 5. A) Results of quantitative RT-PCR analysis. The PCR in Lanes 1-5 contained 1.5mM Mg++ and lanes 6-10 contained 3mM Mg++. (B) A 2% gel was run with the PCR products that were amplified in Real Time PCR. Lane 1 represented BMI-1, lane 2 NSE, lane 3 ABCG2, lane 4 Nestin, lane 5 K18, lane 6 CD44, lane 7 OCT4, lane 8 PSA, lane and lane 9 sca-1.In all the lanes except lane 8 a double band was observed. The two bands represented GAPDH and the gene of interest. For construction of a standard curve, serial dilutions (1ng/  µl, 5ng/ µl, 20ng/  µl and 50ng/  µl) of cDNA were used. In all cases, there was a strong linear correlation between the number of thermal cycles required to generate a significant fluorescent signal above background and the log of the input cDNA amount (correlation coefficient ≠¥ 0.90) (Figure 6). The Ct value was against the log of the initial template amount and subjected to linear regression analysis. Figure 6. Real time RT-PCR: standard curves for cDNA obtained from LNCaP, C42B and DU145 cell lines at 1ng/ µl, 5  µl, 20  µl and 50  µl . A strong linear correlation between the CT values and the log of the input cDNA amount (correlation coefficients ranging from 0.97 to 1.0) were obtained. Quantification and Comparison of the Real Time Quantitative RTPCR results between Adherent cells untreated Prostasphere and treated Prostasphere. Delta Ct values for adherent cells and their correlation with those for prostasphere treated and untreated samples showed high correlation (r 2 ≠¥90) emerged for all of the tested genes ( Figure 6). GAPDH was used as endogenous control. In order to quantify the gene expression of the prostasphere and treated prostasphere (wnt3a and cyclopamine) to adherent cells (C42B and LNCaP), 10 markers were compared by Q-PCR using GAPDH as endogenous control (Fig 8). The PCR products were resolved on a 2% gel to confirm the templates have amplified along with GAPDH as endogenous control (Figure 5). Duplex product was seen in most of the lanes. The method of calculation was by à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct method. This method calculates the fold change in respect to the normalized gene. In our study we have compared the fold changes of gene expression of the treated and non treated prostosphere relative to the cell line (C42B and LNCaP). In the table (Table 2) we calculated delta delta Ct in relation to the cell line. Each of the samples were run in triplicates, therefore an average of those three were taken in each cases. For example for C42B spheres, the Ct values are 30.19, 29.92, and 30.27. The average of this was taken (30.19, 29.92, 30.27)/3 which is 30.13 and the same was calculated for GAPDH which is 18.94. In each case that is sphere, C42B wnt3a treated, C42B control (dissolved in DMSO) and spheres treated with cyclopamine the average Ct was calculated. Table 2. Example of calculation for quantification of gene expression in fold changes. Sample Average Ct a of samples b Average Ct of GAPDH à ¢Ã‹â€ Ã¢â‚¬  Ct à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct RQ Values d Prostasphere 30.13 18.94 11.19 -2.01 4.04 Prostasphere +Wnt3a 31.20 19.75 11.46 -1.74 3.34 Prostasphere control 33.97 22.7 11.27 -1.93 3.82 Prostasphere+ cyclopamine 30.28 19.43 10.9 -2.35 5.09 Adherent Cells c 13.20 0 1 a.Cycle threshold. b.Prostasphere, Prostasphere+wnt3a, Prostasphere control, Prostasphere +cyclopamine. c. For adherent cells the à ¢Ã‹â€ Ã¢â‚¬  Ct value was calculated from the standard curve. d. Relative quantification or fold changes. à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct was calculated by subtracting the Ct of the endogenous control (GAPDH) from the Cts of the gene of interest eg 30.31-18.94=11.19. Fold changes are calculated relative to the adherent cells. Therefore à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct is calculated by subtracting the à ¢Ã‹â€ Ã¢â‚¬  Ct value of the adherent cells from the à ¢Ã‹â€ Ã¢â‚¬  Ct of the sample i.e.11.19-13.20=-2.01. Relative quantification (RQ) value of gene expression was calculated by the use of the equation RQ= 2-à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct RQ=2-(-2.01) Therefore an RQ or fold change relative to the adherent cells is 4.04. Figure 7. Q-PCR analysis of the mRNA levels of Nestin, Sca-1, Oct4, BMI-1, NSE, K18, PSA, CD44, ABCG2 and c-kit. Expressions of the markers were calculated by employing the ΔΔCt method. (A) Nestin expression was decreased in prostaspheres in C42B adherent cell, prostasphere treated and untreated and were insignificant. (B). Effect of Sca-1 on C42B was unchanged between adherent cells and the prostaspheres. However in LNCaP a modest increase was observed. (C) The prostasphere expressed nearly two fold increase in expression. (D) Oct4 expressed about four fold increase in prostasphere treated samples (Wnt3a and cyclopamine). (E) In LNCaP Oct4 expression is reduced in Wnt 3a treated prostasphere. (F) In C42B prostasphere and Wnt3a treated prostasphere BMI-1 showed slight increase in level of expression. (G) However this change is not as pronounced in LNCaP. (H) NSE marker shows very high expression for C42B prostosphere control and marked reduction when treated with cyclopamine. (I) In LNCaP, no such change was observed between Prostasphere and Wnt3a treated prostasphere. (J and K) Keratin 18 shows extremely high levels in prostasphere with reduction when treated with Wnt3a or cyclopamine. (L and M) PSA failed to show significant changes in the level of expression. Although wnt3a and cyclopamine treated samples showed slight reduction. (N and O) CD44 was not expressed in both C42B and LNCaP prostosphere. However the adherent cells had high expression of the marker. (P) ABCG2 shows high expression of prostasphere in C42B. Wnt3a treated spheres showed reduced levels. (Q) In case of LNCaP extreme level of expression of ABCG2 was observed in prostosphere. (R) c-kit/CD117 was expressed more in the prostasphere with reduced expression on the Wnt3a treated and cyclopamine treated samples. Nestin and CD44 showed significant reduction in expression compared to the adherent cells of C42B. Nestin expressed less than 1% in prostasphere (figure 8A,) and negligible expression of CD44 (figure 7N) in C42B. There is increase in expression of SCA-1, OCT4, BMI-1, K18, ABCG2 and C-KIT (Figure 7 B, C, F, J, K, p, Q and R). NSE showed significant increase (Figure 7 H) in prostasphere control (97% more expression than adherent cells) and 100% increase in expression of K18 prostasphere(Figure J and K) and 100% increase expression of ABCG2 in prostasphere, prostasphere treated with cyclopamine treated and control. Interestingly Wnt3a treated prostasphere showed reduced expression of ABCG2 (Figure 7 P and Q). In LNCaP expression of CD44 is insignificant (0.01%) and PSA expression is reduced by 40% (Figure O and M). In case of LNCaP there was 18% increase in expression of SCA-1, 16% of BMI-1, 50% in NSE, 100% in case of Keratin 18 (Figure 7 C, G, I, and K). A summary of the results are shown in table 3. Table 3. Comparison of fold changes in mRNA expression in 10 selected genes determined by real-time quantitative polymerase chain reaction (RT-qPCR). Discussion Collins et al 2005 (41) in their paper states tumour cells are organised as hierarchy that are responsible for the formation of cancer. They have been able to identify and characterise cancer cell population from prostate tumours that have the ability of cell renewal and regenerate expressing differentiated cell products. Various studies have developed non-adherent sphere culture to characterise cancer cells with stem cell like characteristics. In vitro culture in unattached conditions where cells grow in round balls called spheres is routinely used for enrichment and propagation of stem cells (40). Prostate cancer is a heterogenous disease and to study the prostate cancer cells with stem cell characteristics prostasphere were cultured by Dr Prowse. Previous papers have established stem cell markers namely CD44+, CD133, ABCG2, ÃŽ ±2ÃŽ ²1 integrin, Sca-1 and ÃŽ ²-catenin and PSA can be utilized to identify stem cell population in normal prostate (29,30).However the role of CD117 is yet to be defined in human. Figure 8. The self renewal capacity of cells with stem cell characteristics and the proliferation/differentiation of transit amplifying cells are regulated by WNT signalling. In addition AR activity is the driving force behind proliferation and differentiation of the transit amplifying cell. ÃŽ ²-catenin which is also an effector of WNT signaling can interact with the activity of AR (Bisson and Prowse et al 2009). In the paper by Bisson and Prowse (10), the authors provide evidence that in absence of AR, WNT activity can control the cell renewal capacity of the prostate cancer cells with stem cell characteristics. On basis of their conclusion they suggested a model (figure 2) where the balance of WNT and AR activity not only regulates the self renewal of prostate cancer cells with stem cell characteristics but also the proliferation and or differentiation of the transit amplifying cells. In my study I tried to characterise the stem cell population within the prostate using different stem cell and differentiation markers and measuring their relative gene expression. This evidence can be used to further charaterise tumour stem cells: as they may comprise only a fraction of the cells responsible for the tumour, and have the abilities of self renewal, proliferation and differentiation. Nestin a neuronal marker, is an intermediate filament protein that identifies progenitor cells in adult tissues. Previous papers (31) have provided evidence of detectable levels of Nestin mRNA and these levels were increased in case androgen-insensitive prostate cancer cell lines (DU145). They were undetectable in the androgen dependent cell line LNCaP. While in C42B, Nestin was expressed only in the adherent cells (Fig 8a). Embryonic stem cell marker such as Sca-1 are used to enrich properties such as, replication quiescence, androgen independence, multilineage differentiation and is capable of promoting regenerative capacity of prostate; in short characteristics of stem cells. In consistent with recent reports (32) our study indicated LNCaP cells grown in anchorage independent conditions showed increase in expression of Sca-1 (Figure 8c). Similarly Oct-4 responsible for stem cell self-renewal (33, 34) showed increase expression in C42B prostasphere (figure 8d). NSE is one of the prognostic indicators of aggressive androgen-independent prostate disease. Neuroendocrine cells provide growth and survival signals to surrounding tumour cells and thereby results in an increase in stem cell population (35, 38, 39). Gene expression is significantly increased in LNCaP prostasphere (Figue 8i). This maybe due to acquisition of the neuroendocrine characteristics by LNCaP in response to long-term androgen ablation therapy (35) or the selective differentiation of prostate cancer stem cells into neuroendcrine cells by non-adherent culture. A recent paper (10) investigated the role of WNT on the size and the self renewal capacity of the prostasphere. The authors noted a significant increase of keratin 18 and CD44 expression with the addition of Wnt3a. This increase in expression was detected in adherent and non adherent cultures with LNCaP prostasphere exhibiting slightly higher level than C42B. CD44 is an important marker with a distinct role in migration and signalling and is present in both stem and differentiating cell population. Evidences have been provided that show CD44 to be present in tumour–initiating cells (36, 37). Therefore it is probable the CD44 would exhibit high exp

Leaders vs. Managers: Who would I hire? Essay example -- Business Mana

One of my favorite management quotes says â€Å"Management is efficiency in climbing the ladder of success, leadership determines whether the ladder is leaning against the right wall.† My ideas about leadership and management have been shaped by personal experiences in both the military and private sectors. While there are good and bad leaders in both worlds, the military adds an interesting twist in the requirement to follow the orders of your chain of command and that facets of management are performed at varying steps in that chain. In the military, â€Å"leadership† is imposed as rank is earned. Conversely, in the private sector, leadership is earned or demonstrated in order to achieve â€Å"rank†. I find myself torn between these alternate views of leadership and management as I think of answers to the assigned questions. If I were the CEO of a company, would I hire managers or leaders for my supervisory positions? My answer to this question depends on my company. As the CEO of a start-up company on the cutting edge of my market segment, I would ensure that the majority of my supervisors have the vision and skills necessary to ensure success and future growth opportunities. However, not all functions of the business would require a high level of forward thinking so having managers would also be important. As the book states, having leaders with an entrepreneurial view of the world would be an asset during the development phase of the business but they could become overwhelmed by bureaucracy as the business matures. I think it is important to note that â€Å"leading† is listed as one of the 8 identifiable functions of managers. From a military perspective, as an admiral, I would expect my senior officers to be leaders with an eye on t... ... also results in higher efficiency. Works Cited Babcock-Roberson, M., & Strickland, O. (2010). The Relationship Between Charismatic Leadership, Work Engagement, and Organizational Citizenship Behaviors. Journal of Psychology, 144(3), 313-326. Retrieved from Academic Search Complete database. Covey, S. (1990). The 7 Habits of Highly Effective People. New York: Fireside. Kreitner R. (2009). Management. Canada: Houghton Mifflin Hardcourt. Sterry, T., Reiter-Purtill, J., Gartstein, M., Gerhardt, C., Vannatta, K., & Noll, R. (2010). Temperament and Peer Acceptance: The Mediating Role of Social Behavior. Merrill-Palmer Quarterly, 56(2), 189-219. Retrieved from Academic Search Complete database. Zweig, D. (2010). The Board That Couldn’t Think Straight. Conference Board Review v. 47 no. 1 (Winter 2010) p. 40-7. Retrieved from Academic Search Complete database.

Green Architecture :: Sustainable Building Environment Essays

Green Architecture Green architecture is an approach to building which has become more popular in the last 25 to 30 years. Also known as sustainable design, green architecture is a method of design that minimizes the impact of building on the environment. Once thought of as unconventional and nonstandard, both regulatory agencies and the public alike are quickly accepting green architecture as a socially responsible and logical means of construction. The beginnings of today's green revolution can be traced back to the environmental awareness of the 1960s and European design. New construction techniques have lead to the development of innovative materials and design concepts. Green buildings are designed, constructed and commissioned to ensure they are healthy for their occupants. Successfully designed green projects can involve an extensive array of factors, ranging from the resourceful use of materials, to careful consideration of function, climate, and location. The concepts about green architecture can generally be organized into several areas of application. These areas include sustainability, materials, energy efficiency, land use, and waste reduction. Green buildings are not only designed for present use, but consideration is also been given to future uses as well. An adaptable structure can be "recycled" many times over the course of its useful life. If specific technical issues prevent use of the building for a new function, then the materials used in its construction are designed to facilitate ease of recycling and reprocessing of materials. Buildings consume a variety of materials in their construction. Green design reduces the dependence on resource intensive products and materials. Today, there are an increasing number of products available made from efficient, earth-friendly, or recycled materials. In a green building, consideration is also given to the construction process itself. Materials that minimize waste or can be recycled, help contribute to an efficient and environmentally sensitive construction process. Another important aspect of green architecture is the integration of energy efficient mechanical systems and conservation methods. Green buildings are designed to reduce or eliminate the dependence on fossil fuels. Additionally, green designs further help to minimize waste through the use of gray water recycling and other sustainable energy strategies. Grey water is conserved or saved to be recycled to water gardens. Land use and building orientation also plays a critical role in green architecture. A green building is located to take advantage of its climate and surroundings. These conditions not only affect the efficiency of a building, but of the community and society as a whole.

Three Stikes Law :: essays research papers

Is the â€Å"Three Strikes and You’re Out† law cruel and unusual punishment? The purpose of my research paper is to analize how the â€Å"Three Strikes Law† helps to support our Constitution or violates it. I will discuss where the law came from and why we have it. I will also write about the positive and negative aspects of the law as a whole. I hope to be able to analize the spirit of the law versus the letter of the law as it relates to this subject. â€Å"In 1994 California voters approved a ballot initiative known as "Three Strikes and You're Out." Basically what it means is that people who are convicted of three felonies may end up facing life in prison.† There are some limitations though on how this law is executed. Not any felony constitutes a strike. For the first and second strikes only serious and violent felonies can count as a strike. Also some juvinille crimes can count. For the third strike any felony can be the final blow. While for the first two strikes it takes crimes like rape, kiddnapping, and robbery; the third strike can be a crime as simple as carring brass knuckles. This law â€Å"was enacted in 1994 after Polly Klaas was kidnapped from a slumber party in her home and murderedby Richard Allen Davis, who had two prior kidnapping convictions. The jury recommended that Davis be sentenced to death, and the judge imposed that sentence.† â€Å"On March 7, 1994, Governor Wilson signed into law AB 971 (Ch 12/94, Jones) referred to as the Three Strikes and You're Out criminal sentencing measure. In November, the voters reaffirmed the measure by overwhelmingly approving Proposition 184, an initiative that is essentially identical to Chapter 12. The measure is the most significant change to the state criminal justice system in more than a generation.† Govenor Wilson passed this law as part of his goal to crack down on repeat offenders and dangerous felons. The case of Richard Allen Davis was the prime example of how the law could be effective.

Bullying and Its Effects on Individual’s Education

The purpose of the research in this work is to answer the question, â€Å"Does bullying effect an individual's education? First bullying will be defined in the perimeter of the educational environment. The author of this work takes the stance that bullying does most positively affect an individual in terms of their quality of education and in fact does continue to affect the individual who receives and even the one who perpetrates the bullying behavior. Inclusive in the research will be the stated ‘signs' of bullying behavior taking place, preventative measures that are stated to be effective, types of bullying behavior, and common myths surrounding those who are bullies. Some important facts about violence in schools are stated to be that first, that 1/3 of all injury death that occurs in the United States are due to intentional school violence. Interestingly, as violence has risen quite sharply in society it has also rise in schools and in areas surrounding and related to school. During the school years from September 1992 through May 2000 the National School Safety Center in their Report on School Associated Violence† (Education World, nd) Unhealthy relationships in the family and school personnel's' exposure to ‘violent television, films as well as games containing some of the elements that seem to contribute to violence in-school behavior. Bullying can take place both directly and indirectly. Bullying is defined as the repeated exposure to negative actions on the part of a student or even on the part of a group of students toward another individual. Stated as being inclusive in this behavior are the factors of aggressive behavior, intentional harm doing, it is done on a repetitious basis and occurs in a relationship on an interpersonal level â€Å"characterized by an imbalance of power.† (Colorado.edu Website, nd) The definition proposed by Tattum and Tattum (1992) states that â€Å"Bullying is the willful, conscious desire to hurt another and put him/her under stress? Therefore, the individual that desires to hurt another individual is a bully. But, those who are not in actuality bullies are those that think better of committing such actions. Bullying may be physical or it may occur on a psychological level. It is suggested by Olweus that an â€Å"imbalance of power† exists when bullying occurs and in fact contributes to the occurrence. As stated bullying behavior may be ‘direct' bullying or ‘indirect' bullying. Direct bullying is an open attack on the individual. Inclusive are physical attacks such as hitting, kicking, pushing, and choking. Attacking someone verbally or through harassment such as calling of names, threatening behavior, taunting behavior, teasing in a cruel and malicious manner, spreading rumors and slandering are all inclusive. Indirect bullying is often difficult to detect much more so than direct bullying. Indirect bullying is characterized by social isolation and social exclusion on an intentional basis, making faces and obscene gestures as well as manipulation of friendships and relationships. III. Common Myths Surrounding Bullying Myth 1: Insecurity and low self-esteem is suffered by bullies and they in turn pick on others towards the end of making themselves feel more secure. Fact: Self-esteem among bullies are average to above-average however they do have temperaments that are aggressive as well as a ‘lack of empathy and poor parenting.' (Starr, 2000) Myth 2: Bullies are looking for attention however; ignoring the bully will stop the behavior. Fact: control is what the bully seeks and they tend to cease their bullying when ignored however if adults do not address the issue of bullying the bully generally is propelled toward another level of bullying. Myth 3: Boys will act like boys. However bullies general remain bullies and eventually get involved in a life of crime. Fact: Of all those finishing middle school that are bullies sixty percent will have committed at least one crime by the age of 24. Fact: Outgrowing bullying does not actually occur but it is redirected by the individual doing the bullying. 60 percent of bullies will have committed a crime by the age of 24. Myth 5: Standing up for themselves is something that needs to be learned by victims of bullies. Fact: Bullies generally pick those who are younger or weaker to bully and those who don't have the skills on a social level for the development of friendships that are important and are unable to effectively deal with social situations on their own. Fact: Victims are generally chosen to be bullied due to their being â€Å"sensitive, anxious, and not likely or unable to retaliate, not due to differences on a physical level. (Starr, 2000) Myth 6: The environment in large classrooms and large schools are conducive to bullying. Fact: There has been no established link between the size of the educational facility and instances of bullying. In fact there is some research that contains findings that there is less and not more bullying in larger schools. Myth 7: The largest part of bullying occurs somewhere other than school grounds. Fact: Most bullying occurs on school grounds. Myth 8: Only a small number of students are affected by bullying. Fact: In the U.S. 25% of students are victims of bullying and 20% are bullies. It has been estimated by the National Association of School Psychologists that 160,000 children don't attend school each and every day to avoid being bullied. Myth 9: If bullying is a problem in the classroom the teacher is aware of it. Fact: Reports by the victims of bullying instances are done only reluctantly out of fear of being retaliated against, due to embarrassment and because most bullies tend to justify their behavior. Myth 10: Sticks and stones will break your bones but names will never hurt you is an adage that should be followed by victims of bullying. Fact: Problems that affect students for life are low self-esteem and depression as well as suicide and mental health issues. IV. Preventative Measures in Counteracting Bullying in School Four basic principles for prevention of bullying and victim problems are stated as follows: â€Å"Awareness and warm, positive involvement of adults inclusive of teachers, principals, school counselors, and parents.† (Safe Schools Fact Sheet, Colorado.edu) Set and stick to firm limits as to what behavior is unacceptable firmly stating that bullying is not allowed or acceptable in the school. Consistent application of â€Å"non-hostile, nonphysical negative consequences for rule violation and unacceptable behavior; and â€Å"Encourage adults to act as authorities and position role models in students' academic learning and social relationships in school.† (Safe Schools Fact Sheet, Colorado.edu) The Results and Outcomes of Bullying Behavior and Victims It is clearly without question that the victims of bullies have lifelong problems and issues that result from being bullied. Stated long-term effects on victims are that depression exists as well as low self-esteem. Clinical implications are stated to be a â€Å"risk factor for poor psychological health† (Rigby, 2003). The risk is stated to be greater if the â€Å"bullying is severe and prolonged and if the victim lacks adequate social support.† (Rigby, 2003) Further stated by Rigby (2003) is that â€Å"Various strategies or treatments may be considered to reduce the changes of a child' further involvement in bullying that may worsen the condition. These include assisting victimized children to develop self-protective assertiveness skills and working therapeutically with bullying children to establish a greater awareness of the consequence of their antisocial behavior.† Other findings are that victims of bullying behavior have higher rates of absenteeism than those who do not experience bullying at school. Long-term adjustment is also affected by being bullied at school as well as the victim of bullies developing an aversion to the environment of school. (Rigby, 2003) In Factsheet Number 18 entitled, â€Å"The Emotional Cost of Bullying† it is stated that bullying can affect the physical and mental health of a child in a serious way. Children who are bullied â€Å"lack confidence, feel bad about themselves, have few friends and spend playtime alone. They may find it hard to face going to school and difficult to concentrate on their work. They may complain of various physical symptoms as a result of their upset. They may worry and try to avoid going to school. Others become very anxious, find it hard to sleep and may feel depressed, or even suicidal. These problems can carry on long after the bullying has stopped.† (Factsheet #18, Mental Health & Growing Up)A large-scale study conducted in England and Wales found that children who suffer from being bullied are more likely to wet the bed and to not sleep well along with feeling irritable, nervous, and panicky after being bullied. Recurring memories of the incidences were stated by 32% of victims in the study and 29% of the victims found concentrating hard for them to do Interestingly the bullies also have long-term effects as well. Stated is that students who bully are also likely to engage in antisocial and delinquent behaviors such as vandalism, shoplifting, drug use, and truancy. This is particularly true of boys that bully. Bullies are also more likely (4 times more likely) to be convicted of crimes by the age of 24. Finally physical bullying is considered to be a risk factor on a moderate level for serious violence acts between the ages of 15 to age 25.

Poem Analsys

After reading The Eagle and Hawk Roosting, there were several differences and similarities that I noticed between them. Some of these brought them closer to each other while others made them more independent of each other. In both poems the main characters of the hawk and the eagle seem to be aware of their surroundings in a humanistic way. The Eagle, while being much shorter than Hawk Roosting, is still able to impart the feeling that he is the master of his domain.I think that Hawk Roosting, however, is able to give more relatable sensory details than The Eagle because of the perspective that it was told from. Because of the first person point of view in Hawk Roosting the author is also able to use personification to make himself seem more important. In The Eagle, a sense of importance is still present, but it can be overlooked because of the third person point of view. While only The Eagle uses rhyme, the rhythm in both poems helps to move the reader through it.They both have sens ory details for sight, but I think that Hawk Roosting uses the sense touch in a very personal way with the phrase â€Å"My feet are locked upon the rough bark. † While both poems impart a feeling of power and majesty, they convey different parting experiences for the reader. Hawk Roosting ends with the hawk believing that he is the master of everything. The Eagle, I believe, finishes with a sense dignity.